| bc_cure_depth {CellBarcode} | R Documentation |
bc_cure_depth filters barcodes by the read counts or the UMI counts.
bc_cure_depth(barcodeObj, depth = 0, isUpdate = TRUE) ## S4 method for signature 'BarcodeObj' bc_cure_depth(barcodeObj, depth = 0, isUpdate = TRUE)
barcodeObj |
A BarcodeObj object. |
depth |
A numeric or a vector of numeric, specifying the threshold of
minimum count for a barcode to kept. If the input is a vector, if the vector
length is not the same to the sample number the element will be repeatedly
used. And when the depth argument is a number with negative value, automatic
cutoff point will be chosen by |
isUpdate |
A logical value. If TRUE, the |
A BarcodeObj object with cleanBc slot updated or
created.
data(bc_obj)
d1 <- data.frame(
seq = c(
"ACTTCGATCGATCGAAAAGATCGATCGATC",
"AATTCGATCGATCGAAGAGATCGATCGATC",
"CCTTCGATCGATCGAAGAAGATCGATCGATC",
"TTTTCGATCGATCGAAAAGATCGATCGATC",
"AAATCGATCGATCGAAGAGATCGATCGATC",
"CCCTCGATCGATCGAAGAAGATCGATCGATC",
"GGGTCGATCGATCGAAAAGATCGATCGATC",
"GGATCGATCGATCGAAGAGATCGATCGATC",
"ACTTCGATCGATCGAACAAGATCGATCGATC",
"GGTTCGATCGATCGACGAGATCGATCGATC",
"GCGTCCATCGATCGAAGAAGATCGATCGATC"
),
freq = c(
30, 60, 9, 10, 14, 5, 10, 30, 6, 4 , 6
)
)
pattern <- "([ACTG]{3})TCGATCGATCGA([ACTG]+)ATCGATCGATC"
bc_obj <- bc_extract(list(test = d1), pattern, sample_name=c("test"),
pattern_type=c(UMI=1, barcode=2))
# Remove barcodes with depth < 5
(bc_cured <- bc_cure_depth(bc_obj, depth=5))
bc_2matrix(bc_cured)
# Use UMI information, filter the barcode < 5 UMI
bc_umi_cured <- bc_cure_umi(bc_obj, depth =0, doFish=TRUE, isUniqueUMI=TRUE)
bc_cure_depth(bc_umi_cured, depth = 5)
###