readGeneInput {GeneRegionScan} | R Documentation |
Internal function that will standardise the input of the many different form of sequences that can be used in Bioconductor.
readGeneInput(gene, genename=NULL)
gene |
|
genename |
This function is not meant to be run directly by the user. It will take a number of genes either as a vector of characters, a path to a FASTA format file, as a vector of DNAstrings or as a readFASTA format. It will then output them in FASTA format for use with other functions. Optional variable genename forces a new name.
The primary objective of this function is to make the sequence input simpler for other functions.
A list of all sequences and their names, in exactly the same format as obtained with the readFASTA function of the Biostrings package.
Lasse Folkersen
somegene<-"ATACCTTGTAGGACCTGATGATAGATGCATAGTAATATCGTA" genename<-"My favourite gene" GeneRegionScan:::readGeneInput(somegene,genename=genename)