CHANGES SINCE Biostrings 1 (v 1.4.z)

o The following bugs and design flaws found in Biostrings 1 have been
  addressed:

  a) matchDNAPattern() was broken in many ways:

     - The "offset problem":
         > d <- DNAString(c("AA","TTT"))
         > m <- matchDNAPattern("TT", d[2])
       was returning wrong matches.
       This problem was in fact the consequence of a flaw in the design
       of the BioString class and was the first motivation for reworking
       the core Biostrings classes that are the fundations of Biostrings 2
       (see the Biostrings2Classes vignette for an introduction to these new
       classes).

     - The "negative offset problem":
         > matchDNAPattern("AAA", "ACT", mismatch=2)
       was displaying a first empty match.

     - The "fuzzy searching" problems:
         Pb1: Fuzzy searching (mismatch != 0) was almost always returning a
         wrong result because of a bug in the implementation of the "shift-or"
         algorithm.
         Pb2: Only mismatch <= 3 was supported (now it's illimited even if
         it doesn't make sense to use mismatch >= length(subject)).
         Pb3: Some "of limits matches" (i.e. matches starting before the first
         letter of the subject or ending after its last letter) could be
         missing. And when they were found, the show() method was in general
         not able to display them properly.

     - This was provoking a bus-error bug on Solaris 2.9 and Mac OS X:
         > pattern <- DNAString("AAAA")
         > subject <- DNAString("AAAAC")
         > matchDNAPattern(pattern, subject, mis=2)

  b) Time of 'DNAString(src)' was quadratic in respect to 'length(src)' ('src'
     being a character vector). In Biostrings 2 this has been replaced by
     'BStringViews(src, "DNAString")' which is much faster (linear in time).

o Other bugs in Biostrings 1:

  - The Boyer-Moore algorithm was reported to be broken by Martin:
      > d <- DNAString("GACTGGTAAAAGTCGGCCGAGGAC")
      > matchDNAPattern("AA", d, algorithm="boyer-moore")
          Object of class BioString with
      Pattern alphabet: -TGCANBDHKMRSVWY
      Values:
      [1] AC
      [2] TA
      [3] AA
      [4] AA
      [5] AA
      [6] AG
      [7] GA
    The algorithm has not yet been ported to Biostrings 2 (but will be ASAP).

  - alphabetFrequency(x) was broken when x had "out of limits" offsets:
      > m <- matchDNAPattern("AAA", "ACT", mismatch=2)
      > alphabetFrequency(m)
      Error in alphabetFrequency(m) : found pattern (0) not in mapping
    (This still doesn't work in Biostrings 2, see TODO file.)

o Changes in the API:
  - No more BioString class: it has been replaced by the BString, DNAString,
    RNAString and BStringViews classes.
  - A BString object can be used to store a plain string and a DNAString
    (or RNAString) object can be used to store a DNA (or RNA) sequence.
  - No more NucleotideString() method: use the BString(), DNAString(),
    or RNAString() functions instead.
  - The DNAString() function is _not_ vectorized anymore. You need to use the
    new BStringViews() method when 'src' is a character vector of length > 1.
  - New constructors BString() and RNAString() follow the DNAString() new
    behavior: they are _not_ vectorized.
  - The as.list() method for BStringViews objects. This allows constructions
    like 'for (b in as.list(v)) ...' and 'lapply(as.list(v), ...)'.
  - New generics: subBString(), subject(), first(), last(), width(), desc(),
    BStringViews(), reverse(), complement(), countPattern() and mismatch().
  - New functions: letter(), BString(), RNAString(), views(), adjacentViews().
  - Renamed functions: matchDNAPattern() has been replaced by matchPattern().
  - Deprecated functions: matchDNAPattern().

o New features:
  - A new format for displaying BString or BStringViews objects.
  - New [, == and != operators for BString objects.
  - New [[, == and != operators for BStringViews objects.
  - BStringViews() (the replacement for the vectorized DNAString() found in
    Biostrings 1) has a 'sep' argument).
  - reverseComplement() has been splitted in 2 separate functions reverse()
    and complement(). 'reverseComplement(x)' is now a shortcut for
    'reverse(complement(x))'.
  - matchPattern() has a 'fixed' argument.
  - See man pages for all new generics and functions listed in previous
    section for all the details.

o Changes in the semantic:
  - reverse() and reverseComplement() don't reverse the order of the views.

o A few minor features have been temporarly removed (no listing provided).

o Documentation:
  - The biostDemo.Rnw vignette has been replaced by 2 vignettes:
    matchPattern.Rnw and Alignments.Rnw
  - 2 new vignettes (work in progress): Biostrings2Classes.Rnw and
    DNAStringVectorization.Rnw.

