| seq2id {lumi} | R Documentation |
The nuID (nucleotide universal identifier) is uniquely corresponding to probe sequence. The nuID is also self-identification and error checking
seq2id(seq)
seq |
a nucleotide sequence composed of A, C, G, T (U). |
The nuID is a exact mapping of nucleotide sequence based on Base64 encoding scheme. A character set A-Z, a-z, 0-9, "_" and "." is used to represent to the base-64 numbers of 0-63. The first character of nuID is a checking code, which provide information of both the number of padded "A"s at the nucleotide sequence and error checking. Please refer to reference for more details.
A string represents nuID
Pan Du
Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", Biology Direct 2007, 2:16 (31May2007).
seq <- 'ACGTAAATTTCAGTTTAAAACCCCCCG' id <- seq2id(seq) id id2seq(id)